Effects of 3-Adrenergic Receptor Activation on Rat Urinary Bladder Hyperactivity Induced by Ovariectomy

Voiding dysfunctions, including increased voiding frequency, urgency, or incontinence, are prevalent in the postmenopausal population. 3-Adrenergic receptor ( 3AR) agonists, which relax bladder smooth muscle, are being developed to treat these conditions. We utilized the rat ovariectomy (OVX) model to investigate the effect of ovarian hormone depletion on bladder function and the potential for 3AR agonists to treat bladder hyperactivity in this setting. OVX increased voiding frequency and decreased bladder capacity by 25% in awake rats and induced irregular cystometrograms in urethane-anesthetized rats. Reverse transcription-polymerase chain reaction revealed three ARs subtypes ( 1,2,3) in bladder tissue, and immunostaining indicated 3AR localization in urothelium and detrusor. Receptor expression was not different in OVX and SHAM rats. The 3AR agonist selectivity of BRL37344 [( )-(R*,R*)-[4-[2-[[2(3-chlorophenyl)-2-hydroxyethyl]amino]propyl]phenoxy]acetic acid sodium hydrate], TAK-677 [(3-((2R)-(((2R)-(3-chlorophenyl)2-hydroxyethyl)amino)propyl)-1H-indol-7-yloxy)acetic acid], and FK175 [acetic acid, 2-[[(8S)-8-[[(2R)-2-(3-chlorophenyl)-2hydroxyethyl]amino]-6,7,8,9-tetrahydro-5H-benzocyclohepten-2yl]oxy], ethyl ester, hydrochloride] was confirmed by examining the relative potency for elevation of cAMP in CHOK1 cells overexpressing the various rat ARs. Intravenous injection of each of the 3AR agonists (0.1–500 g/kg) in anesthetized rats decreased voiding frequency, bladder pressure, and amplitude of bladder contractions. In bladder strips, 3AR agonists (10 -10 4 M) decreased baseline tone and reduced spontaneous contractions. BRL37344 (5 mg/kg) and TAK-677 (5 mg/kg) injected intraperitoneally in awake rats decreased voiding frequency by 40 to 70%. These effects were not altered by OVX. The results indicate that OVX-induced bladder dysfunction, including decreased bladder capacity and increased voiding frequency, is not associated with changes in 3AR expression or the bladder inhibitory effects of 3AR agonists. This suggests that 3AR agonists should prove effective for the treatment of overactive bladder symptoms in the postmenopausal population. Lower urinary tract (LUT) dysfunctions, including increased voiding frequency, urgency, incontinence and nocturia, increase in the elderly population and following menopause (Stewart et al., 2003). These dysfunctions could result from hormonally induced changes in bladder contractile and/or relaxing mechanisms. Bladder contractions are triggered by parasympathetic nerves, which release ACh that in turn activates postjunctional muscarinic receptors (mAChRs) in the detrusor. Bladder relaxation is induced by release of norepinephrine from sympathetic nerves, which activates -adrenergic receptors ( AR) (Fowler et al., 2008). Although drugs that block mAChRs are presently mainThis work was supported in part by Procter & Gamble Pharmaceuticals, Incorporated; the American Urology Association [Research Scholar Award] (to F.A.K.); and the National Institutes of Health National Institute of Diabetes and Digestive and Kidney Diseases [Grant DK49430]. Preliminary findings have been published in abstract form: Kullmann FA, Limberg BJ, Shah M, Contract D, Downs TR, Wos JA, Rosenbaum JS, and de Groat WC (2008) Effects of beta3 adrenergic receptor activation in rat urinary bladder after ovariectomy; 2008 Society for Neuroscience Meeting; 2008 Nov 15–19; Washington, DC. Society for Neuroscience, Washington, DC. 1 Current affiliation: Urogenix/Astellas, Durham, North Carolina. 2 Current affiliation: CincyTechUSA, Cincinnati, Ohio. Article, publication date, and citation information can be found at http://jpet.aspetjournals.org. doi:10.1124/jpet.109.155010. □S The online version of this article (available at http://jpet.aspetjournals.org) contains supplemental material. ABBREVIATIONS: LUT, lower urinary tract; AR, -adrenergic receptor; OAB, overactive bladder; OVX, ovariectomy; SHAM, sham surgery; RB, retired breeders; SD, Sprague-Dawley; CMG, continuous infusion cystometry; ICI, intercontraction interval; IHC, immunohistochemistry; A, amplitude of contractions; BP, baseline bladder pressure; PTh, pressure threshold; CHOK1, Chinese hamster ovary cells; NVC, nonvoiding contraction; ACh, acetylcholine; mAChR, muscarinic acetylcholine receptor; BRL37344, ( )-(R*,R*)-[4-[2-[[2-(3-chlorophenyl)-2-hydroxyethyl]amino]propyl]phenoxy]acetic acid sodium hydrate; TAK-677, (3-((2R)-(((2R)-(3-chlorophenyl)-2-hydroxyethyl)amino)propyl)-1H-indol-7-yloxy)acetic acid; SR59230A, oxalate salt, 3-(2-ethylphenoxy)-1[(1S)-1,2,3,4-tetrahydronaphth-1-ylamino]-(2S)-2-propanol oxalate; ICI 118551, ( )-1-[2,3(dihydro-7-methyl-1H-inden-4-yl)oxy]-3-[(1-methylethyl)amino]-2-butanol hydrochloride; CL316243, disodium 5-[(2R)-2-[[(2R)-2-(3-chlorophenyl)2-hydroxyethyl]amino]propyl]-1,3-benzo dioxole-2,2-dicarboxylate; YM178, (R)-2-(2-aminothiazol-4-yl)-4 -{2-[(2-hydroxy-2-phenylethyl)amino]ethyl} acetanilide; CGP12177, 4-[3-[(1,1-dimethylethyl)-amino]-2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazol-2-one hydrochloride; DMSO, dimethyl sulfoxide; BSA, bovine serum albumin; PCR, polymerase chain reaction; r, rat; h, human; ANOVA, analysis of variance; c/w, cells/well; V, virgin; FK-175, acetic acid, 2-[[(8S)-8-[[(2R)-2-(3-chlorophenyl)-2-hydroxyethyl]amino]-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl]oxy], ethyl ester, hydrochloride; FAM, fluorescein amidite; [I]CYP, iodocyanopindolol; qPCR, quantitative polymerase chain reaction. 0022-3565/09/3303-704–717$20.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 330, No. 3 Copyright © 2009 by The American Society for Pharmacology and Experimental Therapeutics 155010/3503548 JPET 330:704–717, 2009 Printed in U.S.A. 704 http://jpet.aspetjournals.org/content/suppl/2009/06/10/jpet.109.155010.DC1 Supplemental material to this article can be found at: at A PE T Jornals on A ril 3, 2017 jpet.asjournals.org D ow nladed from stream therapy for the treatment of overactive bladder (OAB) symptoms, considerable attention is now being focused on AR agonists as an alternative treatment. Three subtypes of ARs, 1AR, 2AR, and 3AR, are expressed in bladder of several species, including human and rat (Yamaguchi and Chapple, 2007). 3ARs, which are considered the predominant subtype in human bladder, are coupled to excitatory Gs and inhibitory Gi proteins (Vrydag and Michel, 2007). Muscle relaxation is achieved via stimulation of Gs, which increases cAMP. Activation of large conductance Ca -activated K channels has also been implicated in the mechanism of action (Frazier et al., 2008). Stimulation of 3ARs using selective agonists, including BRL37344, CL316243, FK175, or YM178 improved bladder function (i.e., decreased voiding frequency) in normal rats and in rats with detrusor overactivity (Fujimura et al., 1999; Woods et al., 2001; Kaidoh et al., 2002; Takasu et al., 2007; Leon et al., 2008). 3AR agonists also relaxed rat bladder smooth muscle strips (Fujimura et al., 1999; Longhurst and Levendusky, 1999; Woods et al., 2001; Takeda et al., 2003). Relaxation of rat detrusor can be mediated by all ARs (Yamaguchi and Chapple, 2007). In tissues where 2ARs and 3ARs are coexpressed, the 2/ 3 receptor heterodimer can mediate unique signals (Breit et al., 2004). Furthermore, substantial species selectivity exists for 3AR-mediated ligand binding and signaling between rodent and human (Rozec and Gauthier, 2006). Hence, for pharmacological studies, the selectivity of the ligand for rat 3AR should be verified, particularly when using ligands optimized for human 3AR. Hormonal status and aging affect bladder structure and function, including axon degeneration (Zhu et al., 2001; Fleischmann et al., 2002) and changes in the cholinergic (Diep and Constantinou, 1999; Yoshida et al., 2007) and adrenergic innervation (Matsubara et al., 2002; Dmitrieva, 2007). Hormonal depletion after ovariectomy (OVX) is associated with increased voiding frequency in awake and anesthetized rats (Diep and Constantinou, 1999; Liang et al., 2002; Dmitrieva, 2007; Yoshida et al., 2007). Bladder strips from OVX and old rats exhibit decreased responsiveness to cholinergic stimulation (Diep and Constantinou, 1999), decreased tetrodotoxin-sensitive ACh release from nerve fibers, and increased tetrodotoxin-insensitive basal and stretchevoked ACh release from the urothelium (Yoshida et al., 2007). Other studies demonstrated hormonaland/or agerelated alterations in G proteins, AR density, and/or AR responsiveness (Nishimoto et al., 1995; Derweesh et al., 2000; Frazier et al., 2006). Increased levels of Gi protein, which inhibits cAMP production, were suggested as an underlying mechanism for the decreased AR-induced relaxation of the bladder in old (24 months) male Fisher 344 rats (Derweesh et al., 2000). Bladder strips from old ( 22 months) Fisher 344 (Nishimoto et al., 1995; Derweesh et al., 2000) or Wistar (Frazier et al., 2006) male rats were less relaxed by the nonselective AR agonists isoproterenol or norepinephrine and by the selective 3AR agonists (BRL37344 and CGP12177) than bladder strips from young rats. However, other studies found no change in isoproterenol or norepinephrine-induced relaxation of bladder strips from 10and 30-month-old female Wistar/Rij rats (Lluel et al., 2000). In addition, bladder strips from young (2–3 months) OVX rats were slightly more relaxed by BRL37344 than strips from SHAM animals (Matsubara et al., 2002). These studies suggest that the influence of age and hormonal changes on AR pathways in the bladder is poorly defined. Several 3AR agonists are currently in clinical trials for the treatment of OAB (Yamaguchi and Chapple, 2007). Although these trials enroll patients of both genders, the bladders of postmenopausal women may be uniquely influenced by hormonal status. This study investigated the effects of OVX on: 1) 3AR expression in the bladder, 2) voiding pattern in awake and anesthetized rats, 3) detrusor contractility, and 4) the effects of selective 3AR agonists on reflex voiding and detrusor contractility. The results indicate that the OVX-induced increase in voiding frequency and decrease in bladder capacity are not associated with either an alteration in 3AR expression or 3AR agonist-induced suppression of bladder smooth muscle activity in vivo or in vitro, implying a preservation of 3AR function in the postmenopausal state. Materials and Methods Experimental Animals. Female Sprague-Dawley rats (retired breeders, RB, 8–9 months old when received, 300–450 g; and virgins (V) 2–3 months old, 200–250g; Harlan, Indianapolis, IN) were used in this study. Care and handling of the animals were in accordance with the University of Pittsburgh Institutional Animal Care and Use Committee. OVX. OVX and sham (SHAM) surgeries were performed in 9to 10-month-old RB rats anesthetized with isoflurane (2–4% in O2). The ovaries were removed bilaterally via dorsal incisions of the skin and muscle 1 cm lateral to the vertebral column. For sham surgeries, the ovaries were inspected and left in place. The muscle and skin were sutured using silk thread, and rats were given a single injection of antibiotic (ampicillin trihydrate, Polyflex, 100 mg/kg) and returned to their cages. The effects of OVX on the reproductive organs (uterus, fallopian tubes) were assessed during the terminal experiment in each rat. Visual inspection in the OVX animals indicated that the ovaries were missing and that the uterus and the fallopian tubes appeared atrophied, with yellow orange deposits. There was a significant difference between uterine weight of OVX rats compared with SHAM or RB rats (90.8 7.5 mg, n 11 OVX rats; 217.9 14.2 mg, n 9 SHAM rats; 195.7 11.8 mg, n 7 RB rats; p 0.05 for OVX versus SHAM and p 0.05 for OVX versus RB; unpaired t tests). The bladder appearance and bladder weight were not different in OVX or SHAM rats (98.7 2.2 mg, n 10 OVX; 100.3 2.5 mg, n 10 SHAM; p 0.05 unpaired t test). However, when normalized to the body weight, the bladder weights of OVX rats were significantly smaller than those of SHAM rats due to larger body weight in OVX rats (0.28 0.005 mg/g, n 10 OVX rats; 0.32 0.01 mg/g, n 10 SHAM rats; p 0.05 unpaired t test; body weights: 347.6 4.6 g, n 10 OVX rats; 309.2 7.5 g, n 10 SHAM rats, p 0.05 unpaired t test). Drugs, Chemistry, and Synthesis of Specific 3AR Agonists. The 3AR agonists FK175 and TAK-677 were synthesized as described below. Other drugs used in this study include the 3AR agonist BRL37344 (Sigma-Aldrich, St. Louis, MO), the 3AR antagonist, SR59230A oxalate salt (Sigma-Aldrich), the 1AR antagonist, atenolol [4-[2 -hydroxy-3 -(isopropylamino)propoxy]phenylacetamide, ( )-4-[2-hydroxy-3-[(1-methylethyl)amino]propoxy]benzeneacetamide; Sigma-Aldrich], the 2AR antagonist ICI 118551 (Sigma-Aldrich) and the nonselective AR agonist isoproterenol hydrochloride (Sigma-Aldrich). FK175 (1) (Fig. 1A) was synthesized at Girindus America Inc. (Cincinnati, OH), according to previously described methods (Hashimoto et al., 2003), and was stored and handled as a white solid at room temperature. TAK-677 (2) (Fig. 1, B and C) was synthesized using a combination of several published methods. The racemic tryptamine moiety (R,S-3) was synthesized Ovariectomy and 3-Adrenergic Receptors in Bladder 705 at A PE T Jornals on A ril 3, 2017 jpet.asjournals.org D ow nladed from and resolved into the desired individual enantiomer (R-3), according to a previous method (Fujii et al., 2001), and was then successfully converted to the free base (4) using a method described previously (Harada et al., 2004). Ring-opening of (R)-chlorostyrene oxide with the chiral amine, followed by treatment with aqueous NaOH, provided the compound TAK-677 as described previously by the Dainippon Pharmaceuticals Co. (Osaka, Japan) (Harada et al., 2005). Metabolic Cages Studies. Rats were placed weekly in metabolic cages for 2 to 4 times before ovariectomy and followed weekly or biweekly for 5 to 10 weeks after OVX (rats were 8–9 months old before surgery, 9–10 months old at the time of surgery, and 10.5– 13.5 months old when sacrificed, with two animals at 15 months of age). The light cycle was from 7:00 AM to 7:00 PM; food and water were provided ad libitum. Drugs or vehicle were administered intraperitoneally just before 7:00 PM under isoflurane anesthesia. Voided urine was collected in cups attached to force displacement transducers (Grass Technologies, Warwick, RI) connected to a computer. Data were recorded for offline analysis using Windaq data acquisition software (DATAQ Instruments Inc., Akron, OH), and analysis was performed using Excel (Microsoft, Redmond, WA). Data were averaged for 24 h and also analyzed for 12-h periods during the day (7:00 AM—7:00 PM) and night (7:00 PM—7:00 AM). Voiding frequency, total voided volume, and volume per void were analyzed. Voiding frequency was calculated as the number of voiding events per hour during 24 h and during the 12-h day and 12-h night periods. Volume per void, which defines bladder capacity, was calculated as an average of the voids occurring during these periods. For each rat, data from two to four measurements in metabolic cages were averaged and taken as one data point. For drug treatment, in preliminary studies, we tested BRL37344 at doses of 0.1, 0.5, 1, 2, and 5 mg/kg i.p. and established that 5 mg/kg had a consistent and significant effect on voiding frequency. Thus, we used this dose for the experiments included in this article. The effect of BRL37344 lasted for 4 to 6 h; therefore, the data were summarized for 4 h after drug or vehicle treatment. TAK-677 was administered at 5 mg/kg i.p. The vehicles used in this study were saline (0.9% NaCl) for BRL37344, 20% DMSO plus 10% -cyclodextrin in water, or 33% DMSO in saline for TAK-677. For each rat, the drug-induced percentage decrease in voiding frequency in the 4-h interval after drug treatment was calculated relative to the voiding frequency in the 4-h interval after vehicle treatment. Some rats were treated with both drugs, BRL37344 and TAK-677, in different weeks. Continuous infusion cystometry (CMG) was performed as described previously (Kullmann et al., 2008). Rats were anesthetized with urethane (1–1.2 g/kg s.c.; Sigma-Aldrich). The jugular vein was catheterized with a polyethylene-10 catheter for intravenous drug delivery. The urinary bladder was catheterized through the dome using a polyethylene-50 catheter. The catheter was connected to a pump for saline infusion and to a pressure transducer for bladder pressure recording. Voiding responses were elicited by continuously infusing saline (0.9% NaCl) at a rate of 0.04 ml/min at room temperature ( 22°C). Control CMGs were performed for a period of 1.5 to 2 h before drug application. Drugs dissolved in saline or specific vehicles were administered intravenously in small volumes (100– 200 l) followed by 100 l of saline to flush the catheter. BRL37344 was dissolved in saline. FK175 and TAK-677 were dissolved in 100% DMSO (Sigma-Aldrich) and subsequently diluted in saline. The final percentage of DMSO was 0.05% for 10 g/kg drug, 0.5% for 100 g/kg drug, 2.5% for 250 g/kg drug, and 5% for 500 g/kg drug. Saline (100–300 l; n 5 rats) and DMSO (0.05–5% for 300 l; n 4–8 rats) intravenously did not significantly alter CMG parameters (Fig. 8). Drug-induced dose-response curves were constructed using increasing doses of agonists delivered after three to four voidings occurred during instillation of each dose (total time, 50–120 min for each dose). Data were recorded for offline analysis using Windaq, and analysis was performed using Excel and Origin (version 7; OriginLab Corp., Northampton, MA) and Prism 4 (GraphPad Software, Inc., San Diego, CA). The CMG parameters analyzed were: intercontraction interval (ICI; defined as the interval between two voiding episodes), amplitude of contractions (A; defined as the difference between bladder pressure at the peak of the contraction minus baseline bladder pressure), pressure threshold (PTh; defined as the bladder pressure necessary to evoke a voiding contraction), baseline bladder pressure (BP; defined as the lowest bladder pressure just after voiding), and nonvoiding contractions (NVCs; defined as small amplitude, 0.5 cm H2O, bladder contractions before micturition). NVCs were quantified in the last 200 s before micturition contraction using amplitude (threshold set to 0.5 cm H2O) and area under the curve. For each parameter, at least three measurements during the control period and after drug administration were averaged. Data are reported as percentage change relative to control, which was set to 100%. The coefficient of variation of ICIs was calculated as the standard deviation divided by the mean using data from the control period. Bladder strips were prepared as described previously (Birder et al., 2007). The bladder was removed from isoflurane-anesthetized rats, placed in warm aerated Krebs’ solution (118 mM NaCl, 4.7 mM KCl, 1.9 mM CaCl2, 1.2 mM MgSO4, 24.9 mM NaHCO3, 1.2 mM KH2PO4, 11.7 mM dextrose, pH 7.4, when aerated with 95% O2, 5% CO2), and cut into three or four longitudinal strips ( 1.5 8–10 mm), including urothelium. Strips were tied at each end and mounted in a vertical double-jacketed organ bath (15-ml volume) in aerated Krebs’ solution at 37°C. After mounting, the strips were washed several times every 5 to 10 min and allowed to equilibrate for more than 2 h before drug testing. An initial force of 10 mN (1 g) was set as baseline tension, and contractions were measured with a force displacement transducer (Grass, Astromed, RI). Drugs from concentrated stock solutions were directly added to the organ bath every 12 to 15 min. BRL37344 was dissolved in distilled water at 10 2 M and diluted in Krebs’ solution to 10 12 to 10 4 M; FK175 and TAK-677 were dissolved in DMSO at 10 2 and 5 10 2 M, respectively, and diluted in Krebs’ solution to 10 12 to 10 4 M. Vehicles, including saline and DMSO (final concentrations of DMSO were from 1 10 9 to 1%), had no significant effects on bladder strip activity (Fig. 10). Data were recorded and analyzed using Windaq and Excel. The parameters analyzed were baseline tone and amplitude of the spontaneous contractions. For determining the effect of a drug on these parameters, a 3-min window was selected at the time when the effect of a drug was maximal or at 3 to 4 min after drug application. In this window, four to eight measurements of baseline pressure and amplitude of contractions were averaged and taken as one data point. The threshold for the amplitude of spontaneous activity was set to 0.05 g. Results are reported relative to the values before drug application, which were set to 100%. Fig. 1. Chemical structures of FK175 and TAK-677 and synthesis of TAK-677. A, chemical structure of FK175. B, chemical structure of TAK677. C, synthesis of TAK-677. 706 Kullmann et al. at A PE T Jornals on A ril 3, 2017 jpet.asjournals.org D ow nladed from qPCR. Whole bladders were collected from 10 OVX rats and 10 SHAM rats, sacrificed 6 weeks after surgery. RNA from each tissue was generated using TRIzol reagent followed by mRNA Catcher PLUS Kit (Invitrogen, Carlsbad, CA). cDNA from each corresponding sample was then generated using 0.5 g of mRNA and SuperScript III RT (Invitrogen). Approximately 100-ng input cDNA was used for qPCR using custom-made primer sets for 1AR, 2AR, and 3AR (Invitrogen) and the Certified LUX primer set for 18S rRNA FAM (Invitrogen) using Platinum Quantitative PCR SuperMixUDG (Invitrogen). The sequences of the primers used in this study were: 1AR accession number NM_012701: forward primer, NM_012701.1_198FL, cgccGTATGGGCCTACTCCTGG[FAM]G, and reverse primer, NM_012701.1_198FL/219RU, ATCACCAACACGTTGCCCACT; 2AR accession number NM_012492: forward primer, NM_012492.2_398FL, cggttAAGTTCGAGCGACTACAAAC[FAM]G, and reverse primer, NM_012492.2_398FL/418RU, AGATCAGCACACGCCAAGGAG; 3AR accession number NM_013108: forward primer, NM_013108.1_646FL, cgtaacCACCAACCCTCTGCGTTA[FAM]G, and reverse primer, NM_013108.1_646FL/679Rua, ACGATCCACACCAGGACTACTGC. For data analysis, average threshold cycle (Ct) values for all sample sets were calculated, and standard deviation was determined. All primer sets performed at 90% efficiency or greater had an R value of 0.99 or greater and showed a single peak in the dissociation curve. Relative expression levels of all three genes in each tissue were compared to that of the housekeeping gene 18S using the Ct calculation according to eqs. 1 to 3: Delta Ct CtGene X CtHousekeeping Gene (1) Average Delta Ct Average of Delta Cts from all ten rats (2) Relative Expression 2 (Avg. Delta Ct) (3) Relative expression to 18S was averaged for each cohort, and statistical analysis was performed as follows. The RNA expression was first (natural) log-transformed in order to conform to normality assumptions. The estimated geometric means S.E. of log-transformed means were calculated, and pairwise comparisons were made. P 0.05 was considered statistically significant. No multiple comparison adjustment was made. Because standard curves for all AR primer sets were not identical (Y-intercept values for 1, 2, and 3 were 36.0, 37.4, and 33.5, respectively; data not shown), conclusions about relative receptor levels could not be made. Binding Studies. To determine Ki values for unlabeled ligands shown in Table 1, Chinese hamster ovary cells (CHOK1) cells were transfected with the rat (r) or human (h) AR cDNAs using the Lipofectamine 2000 method (5 g of cDNA/100-mm dish; Invitrogen). Stable clones were isolated for r 3AR and h 3AR, and transient r 1AR and r 2AR transfectants were generated for subsequent binding studies. On the day after transient transfection of CHOK1 r 1AR and r 2AR, cells were plated [15,000 cells/well (c/w) for transients and 40,000 c/w for r 3AR, h 3AR stable cells] into 48-well plates and cultured at 37°C, 5% CO2. Whole-cell binding was performed the next day at 4°C for 5 h with 30 to 80 pM [I]CYP for the 1AR and 2AR or 610 to 940 pM [ I]CYP for the 3AR (GE Healthcare, Piscataway, NJ) in the presence of 1 mM ascorbic acid, 0.5% BSA, 50 mM HEPES, 1 mM CaCl2, and 5 mM MgCl2. Cells were washed three times with ice-cold phosphate-buffered saline. Cell lysates were collected with ice-cold 2% Nonidet P-40/phosphate-buffered saline, and counts were measured using a Wizard gamma counter. Specific binding for rat ARs in CHOK1 cells utilized for immunohistochemical analysis was determined by whole-cell binding using r 3AR stable cells or transient r 1AR or r 2AR transfectants plated at 30,000 c/w in the presence of 36.1 pM [I]CYP with or without 20 mM isoproterenol. Specific binding for human ARs in CHOK1 cells utilized for immunohistochemical analysis was determined by whole-cell binding using transient h 1AR, h 2AR or h 3AR transfectants plated at 30,000 c/w in the presence of 30 to 80 pM [I]CYP with or without 20 mM isoproterenol. cAMP Assay. Transiently transfected CHOK1 cells with r 1AR and h 1AR and stably expressing r 2AR, h 2AR, r 3AR, and h 3AR CHOK1 cells were used for cAMP studies. The next day after transient transfection (120,000 c/w r 1AR, and h 1AR), CHOK1 stable cells (100,000 c/w r 3AR, h 3AR, r 2AR, and r 2AR) were plated into 24-well plates and cultured at 37°C, 5% CO2. Cells were starved for 30 to 60 min at 37°C in serum-free Dulbecco’s modified Eagle’s medium/F-12, 0.2% BSA, pretreated at 37°C for 30 min in 500 M 3-isobutyl-1-methylxanthine in Dulbecco’s modified Eagle’s medium/ F-12 (no phenol red), 0.2% BSA, and 25 mM HEPES, and then stimulated with ligands in the same buffer for 30 min at 37°C. Reactions were stopped, and cAMP was measured using the GE Healthcare Biotrack kit (GE Healthcare Bio-Sciences Corp.). Immunohistochemistry. Whole bladders were collected from three OVX rats and three SHAM rats (sacrificed 6 weeks after surgery), immediately fixed in formalin (10% neutral buffered formalin; VWR, West Chester, PA), and sent for staining (LifeSpan BioSciences, Seattle, WA). Tissue was embedded in paraffin and sectioned at 4 m. Because of recently demonstrated lack of specificity of commercially available antisera against the 3AR (Pradidarcheep et al., 2009), we chose to confirm that our antibodies recognized the antigen of interest using a heterologous expression system and to verify that a similar staining pattern was obtained in tissue using multiple antibodies generated against distinct epitopes on the 3AR (Michel et al., 2009). The antibodies used were CHAB15688 (chicken antibody AB15688; Millipore, Billerica, MA) and LS-A4198 (rabbit polyclonal antibody LS-A4198; MBL International, Woburn, MA). The CH-AB15688 antibody was generated against a synthetic peptide in the carboxyl terminus of the mouse 3AR, whereas the LS-A4198 antibody maps to the NH2 terminus (amino acids 1–20) of the human 3AR. Both antibodies were tested for reactivity and specificity against each of the ARs when overexpressed in CHOK1 cells (Fig. 4; Supplemental Fig. 1; discussed under Results). Titration experiments were conducted to establish concentrations that would result in minimal background and maximal detection of signal. From the serial dilutions of 20, 10, 5, and 2.5 g/ml, the concentration of 5 g/ml was selected for the study. After deparaffinization with three changes of xylene (3 min each) and rehydration in a descending ethanol series (100% 3, 95% 3, 80% 3, and distilled H2O for 5 min each), the samples were subjected to antigen retrieval via exposure to sodium citrate (0.01 M, pH 6.0) at boiling point for 20 min. Samples were allowed to stand at